CShisMan2_92


Sequence

>CShisMan2_92 (22 EST) Length=618 GAAATACTAAAGAAATAACAGGTTTATTATTTTCTGAAAAGGATAATCGAAAATTATGTACAGCGAACGAAGTATACATG AAATTGGTAAATGTGCAGGCTTTATGAAAAAATACATGGAATCTCACATTTAGTAGAGAAAAGTAATCTGAAGCTAACAT CACATTTTATACAATAGTAAGATATTACGGTGTGTACGTATATATATATATATATAGAACTCCAGATGCCTAGCGAATTA GGCTACTGTGAAAACTCATAATGTACAAAGATTTTATGATACAAGTTAGGTTGGGAACGTAAATGATCTTAGGAAAATTA GCCAACAAATAGTTAAATCATATTACAATCAGAAATCAAGTCGCTGTAAAAATAGAAATAAGGAACAAAGAAAAGACTCT TAAGGCTGAGAGCGCCAATACGTCCTATAGTAAGTACGTGTACGACGAAGTCTCGGTGTGCGAGAAAGTATGACCTGTAT ATCTCTGAGAGTTGCACGATGTGCCCTGAGACTGAGTGCTAATGAAAACCCAGACGTATTTGACACGCTATCACCAGTCC CACCGACACTGGAGACCAACGAGCTTGAATTTGCCGGTAAAGCTTCTAAACTGAGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_92: (22 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145743384934AI066967EST208632Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146043384964AI066997EST208663Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146963385056AI067089EST208759Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147593385119AI067152EST208823Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147853385145AI067178EST208850Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148553385215AI067248EST208922Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148883385248AI067281EST208958Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150613385421AI067454EST209136Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152123385572AI067605EST209287Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152663385626AI067659EST209342Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153123385672AI067705EST209388Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153513385711AI067744EST209427Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154023385762AI067795EST209479Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156093385969AI068002EST209691Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157193386079AI068112EST209802Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157383386098AI068131EST209821Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157493386109AI068142EST209832Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158093386169AI068202EST209893Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158633386223AI068256EST209947Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158883386248AI068281EST209972Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158953386255AI068288EST209979Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159603386320AI068353EST210045Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:13:7 on Thu 23 Nov 117.