CShisMan2_93


Sequence

>CShisMan2_93 (20 EST) Length=616 GTTTGAGTTGGGTACAGCTGATTCAAGGTCACGGAAATTTCCTATTAGAACCCTTCTTTGTAAAATATATTCATCCTATT TTGAAGAAACAATTATTTATCACTTTTAATCATGATGAAAGCCTGGCAATTGGTCGATATTAATGGTGAAGTGATCAACG AAGAAGATATTTCAAGTGTGGGTTCTGATTGGTCATTCATGCAATTCGATCGGGATGATGGATATCCAAGTCGCCCACAT TCGATAGCTGGTCGACGATCAGATACTGAAGTCGAGCATGAATCTCGTTCACCTTCTGCGAACAGTGATTATAACTGTTA TAGCTCTCATTGTAGTCTAGACAGATATAATGAGCCTCCCGTAAGATCGAAAAATGCTAACAAATCAAAAAACAAACATT TGTCAGGGAGTATTCCTGGAAATACACCAATTCCTATAACATCAAAAACCGAAATATTAAAATCTCATCCACGTAATGGA TTACGACCTGGTCATATACATCAGTCCTCCGCTAGAAATTCCAATGGAACACGTCAAATGTTGGCACGTTGGAATGCTTG TCGTAAACAAAATAATCATACAAACCTATGCGTTGATTCTCAACGTTCCAAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_93: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145963384956AI066989EST208655Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146833385043AI067076EST208746Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148303385190AI067223EST208897Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148313385191AI067224EST208898Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148703385230AI067263EST208938Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149183385278AI067311EST208989Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149503385310AI067343EST209021Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149823385342AI067375EST209055Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150023385362AI067395EST209076Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150913385451AI067484EST209166Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153613385721AI067754EST209437Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153713385731AI067764EST209448Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156123385972AI068005EST209694Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156183385978AI068011EST209700Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156623386022AI068055EST209744Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156853386045AI068078EST209767Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156903386050AI068083EST209772Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157563386116AI068149EST209840Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159413386301AI068334EST210025Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159693386329AI068362EST210054Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:46:37 on Fri 24 Nov 117.