CShisMan2_930


Sequence

>CShisMan2_930 (2 EST) Length=359 ACAACATTAGATTTTGTATTAATTTACATAAAACATACAAATAAACAAACCAATTAAGAAACGAAATACAAACAATTCGT TTAAACAAACAAAGAGGAAGAAGAAGAAGGATGGTTTCATGGAAAAATATATAAGTACTATAATAGATGTAGTTCAGAAA ATCGATTCAAGATGATGATTGATTAATTTCTTCAATTATTTTTNGTACTTCATCTTTATTGANTAAATGNTAATTNTCTT TAATACTAACAGTNGCCATTNCTACATTAGTTGAATCAAGTTTTTCTTCCATAACTTGTTTTAAAATTGATAAAGCATGT TTACAACCTTCCATGGTAATGTCATATTTTTATGGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_930: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39340514734T14567SMEST0228Schistosoma mansoni, adult worm, Gloria Franco
17370303189950AA999395MCCE3244.M1FSchistosoma mansoni, cercariae


Date: 10:56:8 on Tue 21 Nov 117.