CShisMan2_937


Sequence

>CShisMan2_937 (2 EST) Length=393 CTGCCACANAATTATTGTTGCATAAAATTAATATTTGTCTAGATGACTACAGAATGATAAAGCAAATTACAATAGAAGAT TCANAATCAACCAAATGATCAAAAACTAATATAAACAACAAATTATTTACAGATTCTAATGAGAATGTAAAGAGTCGGAA AACTTAATCTGTGCTGTATAAATGGAAGTATGCTAGTCTAACCAAATTTGGTGAATTATACAACACAGAATTATGCACAC ACGTCTCTAAATTAACTGTTAATTAAGTTGTCGACGTCGAGCTTTCTATTTTGTCAAAACGTACTTCCATCTCTTCAAGA ATACATGGTGTATACCTTACAACAAGTTTCATAAGTACCGNGTATTCAAAGTCACAGTCTTCAGAGTCATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_937: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179951125884N20712SMNHADA002028SKSmAW
7791321702791AA140567MEEG0228.M1FSchistosoma mansoni, egg stage


Date: 20:53:23 on Thu 23 Nov 117.