CShisMan2_938


Sequence

>CShisMan2_938 (2 EST) Length=398 GGTGACCCATGACGCCAGGACCATTCGATATCCAGATCCAAATATCAAGCCAAATGATACAATCCAGGTGGACATCGCCA CGGGAAAAGTTCTAAACCATATTAAATTTGAACCAGGCAACATGTGTATGGTTACGGGTGGACGTAACTTGGGACGAGTT GGAACTATTACTCAATGGGAACGTCATCCTGGTTCTGTTGAAATGGATCACGTGCGCGACAGCACAGGACATCAGTTCGT CACTCGCCTAAACAATATCTTCATCATTGGAAAGTCAAACAAACCATGGATTTCTCTACCGAAAAACAGGGGTATCAGAT TGTCTATTATTGAAGAGCGCGGATAAGCGAATACGGGCAAGACGCCTTGCTCACTAATTTGCAATAAACTTAGTTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_938: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368933189813AA999258MCCE3055.M1FSchistosoma mansoni, cercariae
17533573228032AI014200MEEG0336.M1RSchistosoma mansoni, egg stage


Date: 18:54:54 on Sun 19 Nov 117.