CShisMan2_94


Sequence

>CShisMan2_94 (2 EST) Length=616 GCACGAGGTGTTGTTGTGAGACGGACTGAGGATATGGTTCACGTTACTGTTGTGTTGTTGCTTGCTCACATAATATTAGT TAAAAGTAGTCGGACGGATCAAAGTAATACTTTATTCATTGGCTCCATATCAGTTCGCGACAAAAGCCATTTCCGTTCGG TTTTCGAAAGACAAATTAGTGAATCGCCGTCTGATGCTTCCAAAGTTTATCATGCCATACTTGGTATTCATTCACTTAGT GAACGGGTCCCTAACCCAGATGCTGCTTGTCTTTCGCTGAACAAACCTATTACCAACCCAGAAGAAGCATTCTATGTGAG TGCGGGCCACAAACTCATCGGTTCTGCAAAGTGTAAGGTACCAAGTTCAGAGGTCGAGAAATTGTCCAAGCAGTTGTTGA CCGAAGACATATCAATTGAAAATCTGTTTTACCTCATTTCGTCTATGAAATATCTGAATATTAAAATTGATGCTAACCAA GTTTTGTCAATAATTAACAAGATTAAAGCCAAAGATACCAGCCCAATGACGTTAAGTTTTGTTTTACAAATTTTGTCACA ACTTCGACTGACGAAATCANACATAAGTGGCCACGTATCTAATATAGATAATGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_94: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147803385140AI067173EST208845Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148263385186AI067219EST208893Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:21:54 on Tue 21 Nov 117.