CShisMan2_940


Sequence

>CShisMan2_940 (4 EST) Length=357 ACAACTGAGAAAACGAAAAAGCAAGCAACAATGCAGTATAAGTAAAAAAGAAATGGAAAGCTCAGTCACTTATAATAAAA AGACGTTCTTTATCGTTTCATATATTGTTAACTAGATAATTCAGTTCAGAAATACAAAATAAACTGGAAAGAGAATTATT GACTGTTACACAAATATTATTTTTGTTCATAAGGACTTAACATTTGCTGCGACATCAGCAATTCCTACTCGCCGTTGGCC AAAATCAAATACTGTATAAACTTTTCTTAAAAATACATCCCCAAATATCCATAACGGGCCACTTGGGAAGTCAGTACCAA TGAAGCAAGTCCTGCAAATTTCGTGAACCATTTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_940: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191691128020N21887SMNHADA019044SKSmAW
18149243385284AI067317EST208995Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149953385355AI067388EST209069Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157063386066AI068099EST209789Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:30:43 on Thu 23 Nov 117.