CShisMan2_943


Sequence

>CShisMan2_943 (2 EST) Length=393 AAGAAGTCGGTTTCCGCCCTGTTACGTTGGCTACAGTACGAGACCCCGCAATAGCAAAAGAATGTTAAGCTCCAACCAGC TACCAAGAAAAAAATGAAGCGAGTCATGTGGAGGCCAATCCAAGGCCACACTGATCTTTAGTGGAGCAATCGGCACCACT TTCCCAGAGCGACATTTTGGTAGAGATGCTTGCTTGGAGGAGGACGAATCGAGTTTCCCGGACTGAGCGACAAGCTGGCA ACGAGTGAGGATCTTAGGAGGGCTAATGAAGTTTGTCAAGACAAGGGAGCAAATGTATGACCAAAACAGCACAAGAAAAA ATATCTCCTTTTTAACAATGTCAAGAGAGATGTTTTCTAAAACCCATCGGTACCCGGTCGAATCGATAAGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_943: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103051907423AA269302MS1MM002.AS6S. mansoni sporocyst Lambda gt11
9103221907440AA269319MS1MM008.AS6S. mansoni sporocyst Lambda gt11


Date: 0:15:42 on Fri 24 Nov 117.