CShisMan2_945


Sequence

>CShisMan2_945 (2 EST) Length=356 GATCATTTTAAAAATGTATTACAATCTTTGGNTCACTAATACTTTTTAACTGTAAACTTGGCATGCCAAAATTCAAACAT AAGATTGTTGTTAAGAGAAAGCTAGTCACACATTTTCCACGTCGCACGAAACAATATGGTACCAAATTATACATTGCGAT TGGTCACTGAACCAAAGAAATGCAATATCAACAAACAAAGACCATAGGCCACAGCCATCAGCTATAGATAAAGTTAAGCA ATAAACCGGGCTTGATCAATACGACAATTAGTAAGTNGGCTGAGCAAATGCAGTAGTCATTCCTCGATGAGCGCCACCAC GACCTGGATGGGCACCGAANTTCCCACCACCGCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_945: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39261514655T14488SMEST0149Schistosoma mansoni, adult worm, Gloria Franco
39407514801T14634SMEST0295Schistosoma mansoni, adult worm, Gloria Franco


Date: 7:21:3 on Sun 19 Nov 117.