CShisMan2_95


Sequence

>CShisMan2_95 (4 EST) Length=809 ATTTCATATTTACGTACATCATTTTCAGTCACTGAGCGTCTTGCAAAGCGCATTGCTTCTTCGAAATGACGACGAGTTAT TTCTGGTACTGGATCAAAATCATCTTCCATAGCATTAGGCTTGTTTTTTTTCTCAGATTCAGCACGTATTTCCGCCTCGA TAGACTCAACGTATTGCTTGTTTACATGCACGCTGACATATTTCTGTGAGGTCAGCACCCGAAAACCCCTGAGTAGCTTC TGCTAGGAAATTAATGTCAACATCCCTTGCAATCGGGGATTTTCTTAAGTTAGCTTTTAGAATATTAACTCTTGAGGCTT CATCTGGCAGTGGAATGTAAATGAGTTGGTCGAGTCTTCCAGGACGCAAGATGGCCCCATCAATAATATCTGGGCGATTA GTAGCACCGATGATAAAAACGTTCTTTTTAGCAGACATACCATCCATTTCGGTTAGAAGTTGGTTGATAACACGATCAGC AGCACCTCCAGCATCACCAACACTACCTCCACGAGCTTTGGCAATCGAGTCCAGTTCATCAAAGAAAAGCACACACGGTG CCGCTTGCCGAGCTTTATCAAAAATGTCCCGAACGTTTGCTTCAGATTCACCAAACCACATAGTAAGGAGTTCAGGTCCT TTGATGCTGATAAAATTAGCTTGACATTNATTCGCAATCGCCTTCGCCAACAATGTCTTACCACAGCCTGGAGGACCATA AAACAGACACCTTTGCTAGGAGTCATGCCGAATTTCAGGAACNTGTCAGGATGTTCAACAGGATACTGAACAGTTCCTGG AGCTCCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_95: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39413514807T14640SMEST0301Schistosoma mansoni, adult worm, Gloria Franco
18146823385042AI067075EST208745Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147603385120AI067153EST208824Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155083385868AI067901EST209588Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:19:21 on Mon 20 Nov 117.