CShisMan2_950


Sequence

>CShisMan2_950 (3 EST) Length=393 TTTCCCGAAGAAAATGATTTATTGAGTTATTACCTTTGTCCCTGCCTCGTGTGGCGCAGAACGGATGATGTCGGAGTCAC CTGGATCTTCAATGGCTAGAGTGCTCACTCTGAAGTATTTGCCACACGCAGTCCCAAGATCGCGGTTGGTTCCGTTGTAG TGATGAACTCCAGTTTTTGACAACATCGCATAGTATTCTATTTCAGTTTTCCTTAACGGCGGAGCATTGTTGGCAATGAT TATCAATCTTGCTCCACCTTTGCGTAAAAGACGAAGTGTTTGCCGTAATCCAATAGAACATTTCCCACTTTTCATCACCA GAGCTAAGCAACTATTAATGGATTCCAAAGCTTTAGCTNTTTTACATCCAGTTGCTGACTTCGCAGTCGGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_950: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344917975973R95603SMNHADA017041SKSmAW
7641921685508AA125689MLLG0256.M1FSchistosoma mansoni, lung stage
8578011832561AA218468MAAD0127.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 14:34:34 on Fri 17 Nov 117.