CShisMan2_952


Sequence

>CShisMan2_952 (3 EST) Length=540 CAATATTTATATTTGCTTTAATCTATTTCTTGATAGTTAGTAGTAAGACTATATTGAAGTAGGAAATTATTTTGATCTTG ATCTGTGGGCCAACAATCTTCAATCCACATGATTATTGATATTACTATTCGGATCTAAATAATTCTTAACTTCTAGCTAT TTCGTCTTATCTATTTCCTTAGTGAGTAGTATAGTCTCTTCTGTGGTTTGTTTCTGGGTTTTTTTATTTGCTATACTATA TACGTTTAATTAATTACATGAGAGTGCATGAATAAATTTTACTCTCATTTAATTTGTATACCTTTCCCTTACTTAATATC AATTTTGATGATGAAATATAGAAAATTTTATGAATTAAAAAAAAAAAAAATTCCTGGTGGGAATTGGGCAGGAGATTTTA TGATTGGTTCTAGGTTTTATGTGTTGGTAGGATGGTTAATTTATTGTTTTTTGGAGCAGTTATATTTAATTAAGTGAGTG GTTAGGATTGAGGTAGTCAAGTCTATATGGTGTACTAGTTGGTTAAGGTGATAGGGGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_952: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823911713229AA143824MCCE0124.M1FSchistosoma mansoni, cercariae
12101222330411AA559715MC031075.NA3TBRI-Saber-cercaria-A
17372723190192AA999637MCCE3650.M1FSchistosoma mansoni, cercariae


Date: 13:19:14 on Wed 22 Nov 117.