CShisMan2_96


Sequence

>CShisMan2_96 (5 EST) Length=615 TGAGTAGTAGTGAATTTCGAAGTATGAAGCAAGTCCAAATGCAAAAGTGGAAACTCCACTAAGAAACATTCCGATGGATA AGAAGTATCTTAGATTGACTCTTTCTGCAAGAAAGCCACTTAGAATCATTGAAACTGCATAAACAAATAAGTAAATATAT TCAAGGCCACCCAATAACTGACTCCAATTGTCGGAATCTAAATACGGCCGTCAACCATACGACAAAAAGCTACCAAACGG TTTCCAGCCCTCAGAAGTGAAACCAACAGTTTTCGGTTGTCCATTTACGCTGGAACGATGAAGAACCGTCTTAACAATGC TAAGGGGTTTTCGTGAGGCATGATAAAATGTGTAGCAGAAGTAAGTAAGCAGGAGAATATATATTGCTAGTCTCCGGAAA TCATTTCGCAGTACCGATGTTTGGAAAGGTCTGTAACATGGGGGTAAAGATCGTTTCATCAAAAACCAACTAAAAAGCGC CAGACCGCTTGAGGTGTTGTTAGAGAATACACACAGTGTAAGCTGACAATTAATTCGGGAATATTTATTATTGAAATTAG GTGATGATAAGCACCAATGGAAAATTTGTGATATCAAGACAATCTGGTCATGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_96: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147833385143AI067176EST208848Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150143385374AI067407EST209089Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150733385433AI067466EST209148Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150763385436AI067469EST209151Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156933386053AI068086EST209775Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:35:12 on Thu 23 Nov 117.