CShisMan2_961


Sequence

>CShisMan2_961 (2 EST) Length=583 GGAGGAAATGATAATATATTATATCGAATATATTCTTTACGTTTATTACCAAATTTTCCTTCCCAACCATACCAACATTN CATTACATGAAATACCCAAAATAATGATTTTCACATTTACCANAAATGATTAAAAAATCTTGATGGCCAATTCATTCTAT CATCCATAATTAAATAAAATGGTATACGATCAATTTGTGTATATTCTTTTTGACATGTACCTTGACCTGGACCACCACAT GGATATTTGGAACCATTAGGTATTGGACAACAAATACCACTACCACCAATTGCTGTAATATTATTTACACATAATTTTGG TATAAGACATTGAACATTTATTATTATTAAATAGAATGTTAGAATAATAATAACCATATATGTTGCATAATAATAATAAT ATTGATTTAATTTATTATAATAATTAATTATAATGAATAATTTAATTAATTTTCAATGAATATTATTCACATGAAATATG TCCATAAAAAGAAAAGGGGGTGGGGAATTTTGTAGGAATTTACTCTATGGTGATATAATTTATTAATAATTGAAATAAAT GTAATCAAATCAACCGATTCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_961: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180641125953N20781SMNHADA008064SKSmAW
14785972804093AA756923MF4MA165.AF3S. mansoni female adult Lambda Zap


Date: 6:55:39 on Tue 21 Nov 117.