CShisMan2_97


Sequence

>CShisMan2_97 (9 EST) Length=957 GAAAATATTTAAACTATTAATTATGTCATATCTGAATATATCTGAATGATCCGAAGACAAATTTTTGTCAAAATAATAAA TAATCAAGACTTCTACAAATAATTTACATCACTAAGCAATCCCTAACTTGGACTGTTAAAGGGAAGCGGAAAAGAAGAAG GCCAAAGAACACATTACGCCGGGAGATTGAAGCAGATATGAAAAGGATGAATAACAACTGGAAAAGACTGTTCAGGAGAG GGTTGAATGGAAAATACCGGTAGGTGGCCTATACTCCTCAACGAGGGGTAACAGGCATAAGTATGTAAGTAAGTAAGTAT ACAAATAATCAACGGGGACATGAATTCGTGGAGATTATTCGACATTGTACATTGTTCATTATGAAAACTGTTACAATTCT TTTCGTTAATATCTTGTATTTCGAATCATAATTCATCTAATATTCTTGGAATAGTTTATGAAAATGTTAAAGGAGAATGT GAGGTATTATCATTGAGAACATTTATAAATTGAAAAAGATGTCCAAGTTANTTTTCACCTTTGATTTTCTTGAATAAATT GGAAACTTTGTTTTTGATACCCAGAATACCTAGGACTATTTTAGCACCAACGCTGAGTGGTTTCTGAGTAGTGATTGNGG ATTCAGGTATTATNTGATCGATCGATCGATGTTGATGTGGTTTCCATTTGTTTAGTTGTTTCGAATGACTTTTCTGTCAT GTAAATCTGCCCCCCACACTTCCGCTCGCATTCTTCTTTGCTTAGAAAGTTGTTTCCATTTCCAAGACATCCACCGTAAT AAAATATTTCACAAGTTTGATTTACACTGTCGTAGTAGAAACGTTTCAATAGAGCTCTGCATATGCCNTCGCCATAATCT AAAAGGCAGTCCGAATTTCCTTTTCGATATGATGCAACACTTTGTACACATATAAGTAGTAATGTTCCATCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_97: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39122514516T14349SMEST0010Schistosoma mansoni, adult worm, Gloria Franco
11529192245754AA508314MAAD0429.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529212245756AA508316MAAD0427.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18149983385358AI067391EST209072Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153463385706AI067739EST209422Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155343385894AI067927EST209615Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155363385896AI067929EST209617Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157553386115AI068148EST209839Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159583386318AI068351EST210042Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 5:10:5 on Sat 18 Nov 117.