CShisMan2_972


Sequence

>CShisMan2_972 (7 EST) Length=358 CTCTCTCTCTCTCTCTCTCTCGCTCTCTTTAAGGTGGTTACTAACACGTAATAAACAGAGACTAACCACAGTTCAACGGA AAAATGGGAAACGACGACGGTCATGGTCCAAAATCCAAAGAACACAAAAAAGATAAATCGCACCATAAGGAGAAGCACAA AGACGGTCATAGTCATCACAGATCGGGTTCAAAACATCGTTCTGGGTCATCGTCTTCTTCATCATCGGATTCCGACCATA AAAAGAAGTAAAAGTCATGGAATTAATAAGAATGAGACAGTTTCCAATTTATTTCCTTAGTTATTTCCTCATTAAAGTTA AATGTTATTAAAATACATTCATTTAAATTAATGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_972: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8578111832571AA218478MAAD0143.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12099422330231AA559535MC070527.NA3TBRI-Saber-cercaria-A
16452033056536AA917142SMTBCEA000087SKSchistosoma Lambda Zap II
16452043056537AA917143SMTBCEA000088SKSchistosoma Lambda Zap II
16891413116510AA952804SMTBCEA000173SKSchistosoma Lambda Zap II cercariae
17369593189879AA999324MCCE3139.M1FSchistosoma mansoni, cercariae
17372173190137AA999582MCCE3540.M1FSchistosoma mansoni, cercariae


Date: 22:5:54 on Sat 18 Nov 117.