CShisMan2_985


Sequence

>CShisMan2_985 (2 EST) Length=372 TTTAGTTTTGTTATACATATTGATTAGTAGTTGAAGTATTGGTTAATCTAGTAAACAGAAATGAATGATTTCACGTTCCC CTTTTTTTTACCCAAATTTTCGTGATTATGTAATGAGTTCATATGTTATGTCTAGTTTGTATCCCACTTGATGTAACTTA CTTTGGAATGCCATATATAATTGGACGTCTGTACACATGCGCACACACACACACATACATACGTACCCACTCATGCGCGC ACACACACTCACGCCCACAACTACATATACCCAGAAATGGAAAGAACTTTGTCAACATTGTTTTTTCTTGTTACTAATTA TCAGAAACTTAATTATCATTATTATTGAATAAATATTAAAATTTGTAATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_985: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369583189878AA999323MCCE3137.M1FSchistosoma mansoni, cercariae
18146783385038AI067071EST208741Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:54:30 on Thu 23 Nov 117.