CShisMan2_987


Sequence

>CShisMan2_987 (4 EST) Length=347 AAATGAAAATTTGTATCATTCTTAGTATTACTGATCGTTGCTTCATTTGGTATTGTCAAAGNAAACTGAAGGAGGCAATA TGAAATCTAACGGAACAAACGAGAAGAATTCTTCAGGGGCAATGTCACTCGCCGGTAACGCTTGGACATGGGCAAATACG TTGTCAGAATATATATGTAAACTGAAGCAAATGTTTCAATTATCAACTTTGGTACAATGATCATTTCATTGTGTAACAAT ATGAATATTAACATTCTTTTTTCTAGTTTATNATGAATAAATAAATAAAAATAGTAATCTATAATGTTAATTTTATATTA GTCAATATATAACTTCAATATATCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_987: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098522330141AA559445MC260432.NA3TBRI-Saber-cercaria-A
12099522330241AA559545MC070542.NA3TBRI-Saber-cercaria-A
12100342330323AA559627MC090716.NA3TBRI-Saber-cercaria-A
12101272330416AA559720MC031082.NA3TBRI-Saber-cercaria-A


Date: 15:6:43 on Wed 22 Nov 117.