CShisMan2_99


Sequence

>CShisMan2_99 (6 EST) Length=737 CTTTCCCAATCCTACCGAAACGCTCAACCAATCGTTCCCGTTCCGGGTTGTGCTGAAGTCTCTGCAAGCGCCTCAGAATC CAATTCGACTGGAGCGAACACAGACACACGTTCCGATTCAACCTGTTCTACCACTTCACTTTCTCGCGTCCGCTTCAACT TGCCCCAATGTCTCACCGAACACTTCGAACTNCCGACTCGGCTTCCGTCTCACCTTCAAATACGCCTTCACCAACTTCAC CATATTCCGCCTCCATCTCACCGACACGCTCAACCAATCGTTCCCGTTCCGGTTGTGCTGCAGTCTCTGCAAGCGCCTCA GACTCCAATTCGACTGGAGCGAACACAGACACACGTTCCGATTCAACCTGTTCTACCACTTCACTTTCTGCGTCCGCTTC AACTTGCCCCAATGTCTCACCGAACACTTCGACTGCCGACTCGGCTTCCGTCTCACCTTCAAATACGCCTTCACCAACTT CACCATATTCCGCCTCCATCTCACCGAACACCGCTCAACCATCGTTCCCGGTTCCGGGTTTGGTTGGCATTGGCCAAGTT CTTCTTGGCAAAGGCCGGCCCTTCCAAGAACTTCCCAAATTTTCCGGAACTTGGGGAAGGCCGGAAACCAACCACAGGTT CCACAACGTTTNCCCGGATTTCAAACCCTGGTTTACTAACCCACTTTCCAANTTTTNCTGGNCNGTTCCCGGCTTTTCCA AANTTTGGNCCCCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_99: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826252160082L81219SCMRAP0318ENR2/ENR2 three hour schistosomula worm
11826312160088L81225SCMRAP0324ENR2/ENR2 three hour schistosomula worm
11826392160096L81233SCMRAP0333ENR2/ENR2 three hour schistosomula worm
11826482160105L81242SCMRAP0361C2/S1 day seven schistosomula mini-library
11826512160108L81245SCMRAP0365C2/S1 day seven schistosomula mini-library
11826562160113L81250SCMRAP0370C2/S1 day seven schistosomula mini-library


Date: 18:30:23 on Sat 18 Nov 117.