CShisMan2_990


Sequence

>CShisMan2_990 (8 EST) Length=1216 CATGCCGTTAACATCACGTTCACCTTACGACAGTAAAACACTACTTGCCTAAATATTATGANTTGCCTCAACCTGATGAC AAAATTCAAGTTATGTACGTAGGGGATAGACGGAAGTGGAGAAAATTTACGCTGCAAAACAATGACTATGCAAGAAGAAC CAAAAGTTCCAGAAAACTGTCCAATGTGGAATTCTGATGGAAGTAGTACTGGTCAAGCTGAAGGTTCCAATTCTGATGTT TATTTAAAACCGTGTGCAATGTTCCGTGATCCATTTCGTGGTGGTAAAAATAAATTAGTCTTATGTGAACTTATAATTAT GATAAGAAACCACATGTTTCAAATCATCGTTATCTCTGTAATCTTGTCATGGAGAAAGCGAAATCTCACCAACCATGGTT CGGTATTGAACAAGAATATGCTCTATTAGATATCGATGGTTATCCATTACAATGGGCCTAAAAATGGTTTTCCTCCACCT CAAGGGACCTTACTATTGTTCTGTTGGAGCGGGTAAAGCACTTGGTCGTGATATACCAGAAGCTNGATACAGAGCATGCA TGTNTGCAGGAGTTAACATTTGTGGTAGCAATGCAGAAGTTATGCCATCACAATGGGANTTCCAAGTTGGACCATGTGAA GGTGTTTCTGCTGGGGATCATTTATGGATGGCTAGATTTATATTACATCGTGTAGCTGAAGACTTTGGAGTGATTGTTTC ACTAGACCCGAAACCAATGCCTGGGAACTGGAATGGTTCAGGAGCGCATACGAATTACTCAACTCTGGCTATGAGGGATC CAAAATCAGGTTTACAAGCAATAGAACATGCTATTGAAAAACTATCGCATAAACACATGGAACATATTCAATGCTATGAT CCTAAACATGGTTTAGACAATCAAAGACGTTTGACTGGTAGTCATGAAACAAGCAGTATTAATGATTTTTCATCTGGTGT TGCAAATAGAGGCAGTAGTATACGTATTCCAAGACAAGTTGCTGAAAATGGTTGTGGTTATTTGGAAGATAGACGTCCAT CATCCAATTGTGATCCATACATGGTCACCAGAATGTTAGTACAAACAACATGTCTTTAATTATTTATTACCATTATTTAC AAAATAATGAAAAACCAATTACACAACAAAGAAATTAATTTTTTTTTGGAAACATAATGTTACTAAATAATCTCAAATGT TTCCNTACAAGTCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_990: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39312514706T14539SMEST0200Schistosoma mansoni, adult worm, Gloria Franco
345012981279R95619SMNHADA008070SKSmAW
4350261154050N33651SMNHADA008069SKSmAW
5137881445041W06821SMEST0457Schistosoma mansoni, adult worm, Gloria Franco
9262981929525AA285206MC1AO011.AEOS. mansoni cercarial Lambda gt11
12099242330213AA559517MC280429.NA3TBRI-Saber-cercaria-A
12101172330406AA559710MC031064.NA3TBRI-Saber-cercaria-A
18157763386136AI068169EST209860Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:14:10 on Mon 20 Nov 117.