CShisMan2_996


Sequence

>CShisMan2_996 (50 EST) Length=1793 GCACGAGGAACTATTGGGATGTATGGTCGGAAGTTATTTTATTGTAATATTGGAGTGTACATGACCCTTTTTTTTTTTCT ACGCCATTTTCACGAGTGTAATTTTAACAACCGGAAATGCAAACGATTCGTCTACTACTTCTGTGTCTGAGTCAACTGAT AACCTTAGCGATACAACTTCTTTATCATCCTCAACTTTCGCTCAAACAGAACCTTCAGCTACGACATTAAGTACAGAGAC TAATGATGTTACTTCAGTAGCAAGTACCGGTATTGATGTTACTGATAAAGCTGGCACCTCTACTCCAGTGAGATCCGAAG GAACTGAGGATATTTCATCAAGTCCTGATAATGTTTCATCTGGGTCCTCTAATTATTCAGAAGGAACTGATAACACAGAG TCGAGTGTTGCGCGACGAACTAACAAATCTGTGATTGCCAGTGTGACTGGGGAAGAGTCTTCGGATGTAGGAACAACGGA GTCACAGTCCTCGGTGAGTCAAATGACCAACTTTCAAGAGGGTGAAACAAGCACGAGGGGAATTGTGTCTTCGAGCATCG AAAGTGAAGAAGAAAAATACCAAACTACATTTACCATAACAGATAATCCTAAGATAGTTACAACGACATCTATCATAAAT GGTGTTTCATCATTAAAAGTGTTTTACACTTTCCAGTTGTTCATTCTGTTTACATTACAAATAGTTTATTAACTAGTATT GGAATAGATTATTTGATTAGCATTTAAATGAATTAGTTGTATCCAAGTTACCCTATCACAAAGAATTCTTCAAATTATAA AAAAGACATTCAATTACTATCATTGCTATTCATTTCATCTACTGAATGATCTACAACATTGAAAGAAAAGACATTTCCCG CTCTTGTGTGTTTTGTTTCTTTTTTTCTTGTTTAAACATTTTTACGCTTTTTTTTTAAAAAAAAAGAAATTGTTGAANTA TTATAATAGTAAATTGGACTAAAGTCTACCGGTTTTCTTTCTTACATTGTTTCTTTAAACAATTTATTTTAATTATTATG TGTTCACTTTACAAACTAGTATTAGACTTTTTCNGATAATAGTCTTACTTATTATTAGTCAAAACTGAATTTTTCTTATT TTTTTAATATTGCGGTTGATAAGTGTCAGCAGAATATCCATTATCATTTGATGATTCTCCATTGTTTTGATCATAATAAT TATTATTAGTAGTATCATAATTTGTTGGAGCATTATAAGTTGAACCACTTCCATATGCAGCATATTCAATTGGTATTTGT CCTTCACTATATTGTCCACTTCCAGTACCAGCAAGTTGATCAAATTTACCACCATTATATTTTCCTTTAGAATATAATTT ACTTTCAATATTAAATTTAGCTTTTACATTTTGTTTACCATATGAATGAACTTTACCTTTTGTATCATAATTAGCAAATT TCTTTTGATATTTACTACCTTTATGGAAATATGTAGTTTGATGATATTTTAATCCTTTATCTGCATTACCATATGCTATA AATTTGCCTTGTGTATGTATTTTACCATGATTATCATTGCCATGATTTTTATCTCCACCATAATAATCATTATTATTGTT ATATTGTCCATTATCAGTATATGTACCATAATTGTCATTTGAATATGGTGTATATGGTATATAAGATTCACCGCCAAATG TACATGATATAATTACTAATAAATACAATGAGATAACACTTTTCATTGTTTTGTTTTTTTTAGAAATAATCTCTACTCTA CTATAATGTCTAGTTGTAAGTAGTCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_996: (50 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343539973943R95213SMNHADA001006SKSmAW
343541973945R95215SMNHADA001036SKSmAW
344658975523R95414SMNHADA009044SKSmAW
344659975524R95415SMNHADA009047SKSmAW
344665975530R95421SMNHADA009076SKSmAW
344852975908R95538SMNHADA001032SKSmAW
344877975933R95563SMNHADA007091SKSmAW
344918975974R95604SMNHADA017042SKSmAW
345047981314R95654SMNHADA020047SKSmAW
4179731125862N20690SMNHADA001027SKSmAW
4236081139709N25361EST000462S. mansoni cDNA
5858871377948U58069SMU58069Schistosoma mansoni adult worm Lambda ZAP II library
5858911377952U58073SMU58073Schistosoma mansoni adult worm Lambda ZAP II library
5858951377956U58077SMU58077Schistosoma mansoni adult worm Lambda ZAP II library
7808101705405H98279SMNHADA015077T3SmAW
8247921769643AA185829MAAD0111.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248001769651AA185837MAAD0121.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248011769652AA185810MAAD0122.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248021769653AA185811MAAD0123.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248041769655AA185813MAAD0125.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248081769659AA185817MAAD0130.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248141769665AA185749MAAD0150.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248201769671AA185755MAAD0163.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248231769674AA185758MAAD0166.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248261769677AA185761MAAD0169.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248301769681AA185765MAAD0173.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248441769695AA185779MAAD0188.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248481769699AA185783MAAD0193.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248711769722AA185806MAAD0250.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248721769723AA185807MAAD0252.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8733151858027AA233975SMIPADA000048M13RSchistosoma mansoni adult worm Lambda ZAP II library
9102171906282AA269214MA1MR037.AA3S. mansoni adult Lambda Zap
11529562245791AA508275MAAD0345.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529572245792AA508276MAAD0340.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529582245793AA508277MAAD0337.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529642245799AA508283MAAD0316.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529722245807AA508291MAAD0305.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529742245809AA508293MAAD0302.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18146123384972AI067005EST208671Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148853385245AI067278EST208953Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150073385367AI067400EST209081Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150123385372AI067405EST209087Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150833385443AI067476EST209158Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151413385501AI067534EST209216Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151503385510AI067543EST209225Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151933385553AI067586EST209268Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152973385657AI067690EST209373Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156773386037AI068070EST209759Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157003386060AI068093EST209782Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158933386253AI068286EST209977Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:58:39 on Sun 19 Nov 117.