CShisMan2_998


Sequence

>CShisMan2_998 (4 EST) Length=346 TAATCACGACTTCCTGACCGACNCGCGGAAAAAATACGCCGCCCCAGTTTTCGCCGGCATTCGGATAAGAAACCCGCACC CAGCAGGATGCGTTTTCGTCGCCACTGTTCAAGCGATCNCNNATGCATGCGCACCTTCACGCGATTGAACTTGTCGGTAT ATATCTCTTCGCCGGACGGTCCCACGACAGTAGCCGTCTGCGTGGACATGACCGGTTTGACATGATCGAACGGACTGCGG AAAGGCACCGTGCGGCGTTGCACCTCGATCGTCGTCACGAAAAAGCCGGTCTTGCGCCGCCAGCATCGATTCGCGATTCC GACGGGACCACGCCGAAACGCCCGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_998: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39175514569T14402SMEST0063Schistosoma mansoni, adult worm, Gloria Franco
39253514647T14480SMEST0141Schistosoma mansoni, adult worm, Gloria Franco
17580093233188AI018852SMEST0490Schistosoma mansoni, adult worm, Gloria Franco
17580313233210AI018874SMEST0513Schistosoma mansoni, adult worm, Gloria Franco


Date: 8:42:30 on Fri 24 Nov 117.