CcruzaQ_1002


Sequence

>CcruzaQ_1002 (2 EST) Length=627 CGAATGAAGCTGAACGCTTCGATTCTGCACGTCCACGGCGGCGTGGGCGCATTTCGTGCTCAAGCGCTCCCCTTCAGCAG TGATTAGTCCTTGCCACGCGCCCCAACTCCCGGGCTGCGCCACGATGGGCAGGATCAATTGATTCTCAAAATTTGCTACT CGGGGAGCCCGGAGATTTGCAACATGTCCTTTAAGGCTCGAATCGTCCCAGGGTTTGGCGATGTCTCCTGAAACCAAGCA TAAGCCTGCCATTGAGGTGGCCGCAGTTAACGTCGCATCCGACGGCCCGTTTTCATCAACAAAGGCGAGCTGCGCCTGGA TATCGCCATGTTGGCGTGCCAAGTCTAACATGTGGGCGGCAGTATCGCTCCACCGCGTTACCGAGTAAAGGGAAACATTG TCATTTCTTTCAAACAACTTGCAGGAATCAGGCACGGGTGTAAAAAAAAGGAAAAAGATTATAAATTATCTAGACGTTAA CAGAACCCTGCTCCTTTAAGGTCACGGCCCTCCCAAAATTCGAAAGACAGGAAAGTGCCATACATAATTGCATTCGTTTT ACCCGAATACATATATAAATTAATTAATTTCGCCAGCTCTCCCGCGATCATTCTCTTCAGAAGCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_1002: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046783340630AI065223TENU2106T. cruzi epimastigote normalized cDNA Library
18303273404603AI075482TENU3074T. cruzi epimastigote normalized cDNA Library


Date: 15:33:55 on Fri 24 Nov 117.