CcruzaQ_1004


Sequence

>CcruzaQ_1004 (2 EST) Length=441 GCCGGCTGCGTGTGTGTGTTTGATGGTAAGAGTAATCTGCATGTGTGCTATCCGCTTCTTCCTATCTTTGCTTTGTTGGG ACTCTCTTGTGCCGCACAGCTGCTCTGCAGGTGTACACACTGACAAACGCACTAGCAGATGCACACGCCATGTTGCGCAC GCTGTGGGGCGGCGTGAACGCTGAGGACGCACGCACGTACACGATTCTTGCTGCGGCTGCCCTTGCGAGGAGGGATGACG GATGACCGCGAATTGTTATGTTGCCGTGCTGCGAGCGTGATTTCCTAGTGCTTGCTGCCCATGGGCGGCGTGGCGTTTTG GTGTCTGGGATTATTGCGGATGGGCTTCAGCCAGCAGCTGCACGGTTTGACGTGTTCCTCCCGCTGTTCGTACGCCGACG GAGGATTCACCGGCTGTGCGGGGCGATGTGCGGGTGCGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_1004: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973823331797AI057931TENU2023T. cruzi epimastigote normalized cDNA Library
18687623482769AI110349TENU3320T. cruzi epimastigote normalized cDNA Library


Date: 18:55:7 on Sun 19 Nov 117.