CcruzaQ_1005


Sequence

>CcruzaQ_1005 (2 EST) Length=440 GAGAAAAAGAAGCGGAAGTTTAACCTGAAGCGAAATTATGCGGCGCAAACAGTGACGGAGCTTCTCAAGAAAAAAGAGAA GCACCACAACGCACTGACAAAGGTGGAGGAGGTTCGGAAGAAACGCCAGGAACAATTTGAGGCGCAAAAAGCAGCGAAGA AGGAAAGGGAGGCGACAAGGATTAAATGCATTCAAAGAAGACACGCAAATAACGCACTTTATGCGCAAAGGACCCCTAAA GGACAGCCGGTCATGAATGGCCGAGTGAAGCTATTGCTGGATAAACTGCAGCATGAGCAAACGAAGAACTGATCCCGTGC GGAAATCTTGTTTTGGAGTCTCCTGTTGCTCTTCTTTACTTTCCCTCATTTCACATTTATACGTCTTGCTTTTTAGCAAG GTTGAGTCATCATCTTTGTCGTCTTTTTACGCCTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1005: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318173411351AI077274TENU3188T. cruzi epimastigote normalized cDNA Library
18687893482796AI110376TENU3932T. cruzi epimastigote normalized cDNA Library


Date: 6:52:8 on Tue 21 Nov 117.