CcruzaQ_1008


Sequence

>CcruzaQ_1008 (2 EST) Length=525 CCCCACCAACTATACGAAAGATTTGGTTTGAGATGTACCACTGGCCATTGTCTTGTGCCAGGTGAAAGACGTCGTTGAAC TTCAGCGGGTGCCGTTCATCTTTCAGTAGTACCTCGCCATTCACAACAACCAGCACGCCGTTACTGAGTGAAGGGTGACA ATCGATGTCTTCTGCCTTGAAAATAGCCTCGTTGAAGCCAAGGTTGGCAAAACGTGCCATGATATTTGCGCCGCCCTGCA GCTGCTCTCCCATCCACGTCATGAGCGAATTGGAACGATACACACCGGCAAGTTGGTCGCGGCTCTTCGAGAAAAACTCG TAGTACTGCCGGCACAAAAGCCACACCAATTTCTTGAAAGGACATCCACTTCTCTTCGTGTTACCTTAGCTTATTTTTCT GTTTAAATGTTTGTTGTGTTTCCTTTTATTTTTATTTCCCTCCCTCTTTTTATTTTTTTTATCTTTTATTTTTTATCCTT TTAATTTTGTCTCGTCTTCGGTTCCAATATAGTACAGAAACTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1008: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776762130859AA433382TEUF0257T.cruzi epimastigote non-normalized cDNA Library
17971233331538AI057672TENU1762T. cruzi epimastigote normalized cDNA Library


Date: 11:13:0 on Sun 19 Nov 117.