CcruzaQ_1013


Sequence

>CcruzaQ_1013 (2 EST) Length=440 TCAAGACATTCGGCCACGAAGCCCTTGACTTCTCCAGACCACTGCACCTGCAACCCCCGAGGACGAATTTCCACGGGAAG AGCGACCCGAACGCACCGCACCGAATGACACAGCAGTTTGAGTTACTGGACGCATCTGCACCTGTCGCTGGTCATGCCAT CACTGTGAAGGACGTTGAGCGCATGGCAGTCAATAAAGAGCAGGAGCAGCGCCCAAATGCGGATCACCATGCAAATGAAG AGGAAGGGCCGAATGGAATGAACAACGGAGATGGTATGATGGAAGAGTTTGTTTTTGGGTGCAATGATGCCGCAGAAGAA ACAACAGCGAACACCAAAGCGTTGCTTTTTTGTGTCAGTGATGCTGCAGCGGTTAAGAAGAAACAGAAGAGCAAAATGGC CGAAACACCACAGGCAGTGCCCAGCGTATATGCAGCATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1013: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190473017895AA891016TENS0866T. cruzi epimastigote normalized cDNA Library
18387123417124AI080872TENU3730T. cruzi epimastigote normalized cDNA Library


Date: 16:2:16 on Fri 17 Nov 117.