CcruzaQ_1025


Sequence

>CcruzaQ_1025 (2 EST) Length=561 GGGAAAAGCTAACAACAAAACCAACAACACCGTGGTGAGCGCGGAGGGTTCGTCCATGCATTCCGCTCTCTACGGTCCCC GCACCCGTGTGGCACCGCCGACACCGCACACACTTGACAAAAGGACGTGCGGGCATATCACCCCTGACACACACAAACTC ACACAAGTGGGAAGAGAATTCGGTAAAGCAGTGGCCACACGCAAAGACTCCAAATCATACACGCCACAACAGCGATGCAT CATGGCAGTTTCCCCACACAAGAAAACACAAAAAAGCGAATTACATGCCTTATGAAAAATCCACGCGATTCGCACAGCAC AAAAGTGCCATGAGACTCCTTTTCCCATTGCATTCGCCATTCATATTCCCAATGCGTAACCCTGCAGACATTACCCCTCC ATGGTAAAAGCAACTGCCTCGTCGTGGTGTCATCGCGCAGCCATCCGCCTGAGTAAGAACAAAGGGAAAATCAGGCGTCC GTCCGCCTGGAGGGAGGGAGAGACTCCACCGCAGGTCCTTCAGGACGCAAACACTCCGCGCCAGTGGCCGGTGTCGTGTG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CcruzaQ_1025: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459223216863AI007353TENU0373T.cruzi epimastigote normalized cDNA Library
18245613392799AI069824TENU2896T. cruzi epimastigote normalized cDNA Library


Date: 0:31:44 on Sat 25 Nov 117.