CcruzaQ_1030


Sequence

>CcruzaQ_1030 (2 EST) Length=439 TCTGACCAAGCGCTGGTCACGGGAGGGTGAGGCGCTCCTTGCAAACGCTTCACTGGACCCCAGTTTTACCCACTACAGAC GAGGCGCGCAGCCATTTCCGTGCCATCACGCGAAAAGTGCCCATTTCTGGTACTACTCCCACGCAGTTTCAAGTCAAGAT TGGTCTGCCCGAGGTAGACAATGACAACCGTTGGCGCGGCGACGAAGACGAGACAGACGACAAGTGGCGTGAGCTTAGAA ATGAACTGAGGTGTGTTGGCGAAAAAGGGAAATTGCGGTTTCACATTGTGGGTTTTCTTTCCGATGGCACCCGGTTCTTT TCAACTTATGTGAATGGAAAGAAAGCGGAAGGGCATAATTTGCAGCAATCTTTTCTGTGCTTTCAAAAAGTTGTGTCGCT GATGTGCACAGGTGACAAGTGGGAGATCGTATGCGCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1030: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188113017659AA890780TENS0627T. cruzi epimastigote normalized cDNA Library
18244483392686AI069711TENU2755T. cruzi epimastigote normalized cDNA Library


Date: 10:11:1 on Fri 24 Nov 117.