CcruzaQ_1033


Sequence

>CcruzaQ_1033 (5 EST) Length=652 AGAAGCAAATCCAGGCCTCNGAGGCTNGANTCGGCANGAGGAAAAAAGGAAAAAAAAAAAAAAAAAAAAACAGGAGCCAG AAAACTAAAGGAACGCAATAAAAATGCCCCCAAAGGAAAATGAGGATTACNTTCCACCGAAGGACAAGGCGGATGTTCTT GCCGAGGANTATGAAAACGCCCACCATGATCGTTCAGGGAGTGACAAAAATGCCCCGAGCCATTCGCTGAAGCCAAANTC GGTGCGTTNATNTTTGCATCTGTGCTCCTTGTCCCGGTGCGCCTCCTTTTTATGCATTGCACGAAATTAATTTTTAAAAA AAGAAAAAATCCCCCGACTTTTTACGCCCCAAAATTGGGGAAAACGGAACTAAACAAAATAAGCGAAACAAATAAAACGA GTAGAATTGGTGGGGCGTGCTGAGAACACATGTGACTTCCAGGATTGACAGCTCAGGCGGGGGAACTAATGGGACTTCTT GTGTTTCCGTCATCTTTAATTTGGTTTTATTCTCGCGTTTTAATTCTCTTTTTTTTTTTTTTCCATATATTTTTTTTTTT AGGGAATTTTAGCGGAGGCGGCATAATTTTTTTTTTTTTTTTTGTGTGTGTGTGTTTGTGTCTACCCGAAGGAATATTGT TGTTTTTGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1033: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063282988506AA879396TENU0262T.cruzi epimastigote normalized cDNA Library
16099552992104AA882993TENS0570T. cruzi epimastigote normalized cDNA Library
16361073046148AA908076TENS0916T. cruzi epimastigote normalized cDNA Library
16945233124099AA958142TENS1678T. cruzi epimastigote normalized cDNA Library
18243453392583AI069608TENU2669T. cruzi epimastigote normalized cDNA Library


Date: 16:21:34 on Fri 17 Nov 117.