CcruzaQ_1052


Sequence

>CcruzaQ_1052 (2 EST) Length=434 CATTCGTTCATTCATTGGCTCATCTCGCACCCTTCACTCTCACTGCTTCCGTTTCATCCTCTTCTTCTTCCGCACAGACG GTTGATGCCGCTCGGTGCCAAACGAACCCACACTTCACCGTGGTGTCAAATAAGTTCACTAGTCTGCATGCACCTTCTTT TTTTCCCCCTTTTCTTTTTTCCGTCTTCTCCTTTTCTTTTGCAAATTAAATACATATCTTAACCAGTTTTGTAAAAATAT GTGGGTTTCTTGCAACCAACTCCCTACTACTACGTGCTAATAAGACTCCAAGAATACGGCGGCTAAAACAACTCTGGTCT AGACTTTGGCAACATGATCCAGTGGCCATCAGGTCCATGCAGGCCACTGAACGACTTCTCTTTAGGCATCAGGCAGTACA GGTAGATCCCGGCAATCAGATAACCCCACACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1052: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896313299298AI050181TENU1428T. cruzi epimastigote normalized cDNA Library
18687443482751AI110331TENU3301T. cruzi epimastigote normalized cDNA Library


Date: 9:39:24 on Fri 24 Nov 117.