CcruzaQ_1053


Sequence

>CcruzaQ_1053 (2 EST) Length=443 TAAAAATCCGTGAAACATGCGTGCGTATTTGTGTGCCTATATATATATAATATAATATAATATATAANGGGAGTGGAGGA TATTCATCCATCAACTCCAGTTCTTTATCGTTCCATCCCATGCCGAGGTGACCACACGCGAAGACTCTATTGGGTGCCAC CTGTGGGAGGCGAGCGTCTGCGTATGCGCGGGGAATGAACGGACAAGCTCGCACGTGGCCCATGACCATATGAAGAGTTT GCCGTGGATGTCGCCACTTGACAAATAACGGCCGTCCGGACTGAAGGCGAGTTGACATCGTGTTCCAGAGATGGTGTGGC CGCTGAATACCCGGTGACGCAGCAGCTTTACCTGCCCACCGCCGCTGTCGGCAAAGACGAGGGCCTGGTTGTTCAGCGAC TGGGCGACCAGCATATCTTCCGTCGGGTGACGTGCAACGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1053: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18302373404513AI075562TENU3139T. cruzi epimastigote normalized cDNA Library
18689953492632AI110425TENU4028T. cruzi epimastigote normalized cDNA Library


Date: 0:19:56 on Thu 23 Nov 117.