CcruzaQ_1054


Sequence

>CcruzaQ_1054 (2 EST) Length=503 TACGCTATTGGTGTTGCAGAACCGCTGAACATTCACATTGAAACCTATGGCACCGGCAAGTATGATGATGGACGCATCCT GGAGATCGTGACGAAGAATTTCAGCTTCGCCCGTACGATATTATAAAGGAACTAGATCTTCGTCGGCCCATATATCACAT GACCTCACGCTTTGGCCACTTTGGACGCGAAGACAAGAGTGGCAGGGGTGGATTTACCTGGGAGAGCCCCAAGAAGCTCG ATGAGTCGTGCTAAGCGAGAAGGGTAGAAGCGTCGTGTAATGTGTGAAGTCTCCCATTTTTTTTCCTTGACGATTTATTG GTGGCCTGCGCTTCCATTTTTTTTTTTTTTGTTTTCCCTTTTTTTCTTATGGTGAATGTTGCGTGGTAACAGGCATTTCC CATCTAAATAATTTAACAGAATTAATTAAGTAAGGAAAAAAAAAACAAAAAACAAAAAAAACTATTTCTTCANTAAGTTT GATATAAACATACGATCTGTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1054: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657863244404AI026578TENU0790T. cruzi epimastigote normalized cDNA Library
17896063299273AI050156TENU1401T. cruzi epimastigote normalized cDNA Library


Date: 22:9:45 on Sat 18 Nov 117.