CcruzaQ_1062


Sequence

>CcruzaQ_1062 (2 EST) Length=438 ACCAAACTTTAGGAAACTGCTTCGAATTATTGATGTGGATCTTGAAAAGGGACAATATGTCATGGAAATTGAAGAGTTTT TTGACGTCACGACATTTCGAGGATCAAAAGGGTTTCTTCTCCGTACAACTTCCTGGGTAGGAAAGGACGGTCATGCCCTT GGAATCGCCTTTCTTGTCGTTGGGGCCTTGTCATTTGTATTGGGTGCAAGTTTTGGTATTGAGTTTTTCTTGCAGCGGAA CAGGGATGATCGCCCGCTGCCGGAACCCAAAGCACGTTGGTACATATTTGACCCCAATGGTGTTGAAATGCGGGTATATT ATGAACAATTAACCAAACGTCAAGTACCCAACCGACAAAGTTTCCAAAATGAAATACAATAAAATCAACTATGGATTTTA TCATACCCTACCTCGTTTTTTTTTTTCTCTCTTAGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1062: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459813216922AI007412TENU0432T.cruzi epimastigote normalized cDNA Library
17459823216923AI007413TENU0433T.cruzi epimastigote normalized cDNA Library


Date: 13:19:25 on Wed 22 Nov 117.