CcruzaQ_1067


Sequence

>CcruzaQ_1067 (5 EST) Length=1051 GAGTTGTTGCTTCCGCGGATGTTTCAGCCGGTGCAGCAGGTGCTTTCGGTGTTGAAAATATGACTCTTTCTTTGGGGGGG GAGCTGTCATAAGAGGTGGATTGTCCNTTCGGTGGTGTAGCATAAAAAGTTCCGGGGGGGTTTCCATTCAGTGTCGTTGA TAATGGTTCTGATGGCGGTGGTACTCCTTACTGCGGCAATGTTAATGGGGATGTTTCTTCGCCTTCAATAGAACTTGGGG GTTCCTCAATTCCTTCGGTTTCTTCTTTCCCTCTCACTGTGCTTGCTGGCGATGCCATGATCACACCATTATCCTGGCTG ATGCCATTTCCTGTTTGTGCACCCAAAGACTGATTGCCGTTTTCGGGACCTTCCTTGACTGAATCCTGCGGCACGAGGCC TAGGNCACAATTCGGCACGAGGCGGCACGAGGCCGACATTCCAGCTGAATATTCAGTATCGAANATTGTAAAANATTCAA ACATTATTTAACCATGACCAGTGAGCGTACCTTCATTGCTGTTAAGCCTGACGGCGTCCAGCGCTGCCTTGTGGGCGAAA TCATTCANCGCTTTGANAAAAAGGGCTACAAGCTGGTTGCTCTGAAAATGCTGCAACCTTCGGCTGAACAGGCTCAGCAG CACTACATTGATTTGGCCTCGAAGCCGTTCTACAAAGACCTTGTCGCGTACTTTTCCTCCGGTCCGATTGTTGGCATGGT GTGGGAAGGCAAGGGTGTCGTGAAGGGCGGCCGTGTGCTGCTGGGCGCAACAAACCCTGCTGACTCACTCCCTGGCACGA TTCGTGGTGACTTTGCCGTTGACGTGGGCCGAAACGTGTGCCATGGCTCTGACAGCGTTGACAGCGCTAAGCGGAGGATC GCATTCTGGTTCAAGCCGGAGGAACTCGTGAACTGGACATCACATTCCGTCAAGCAGGTCTACGAGTCTGCATAGACCTT GAGGAATAAACTTTTAAGAAGATATGTATAATGTAATTAACTGAAGAGGTGAGGTGAGAATCAAATACGTCCAAAAGGCG CTTTCTAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1067: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786911542831D87312D87312Trypanosoma cruzi Y (Tomoo Tanaka)
16887993115569AA952473TENS1411T. cruzi epimastigote normalized cDNA Library
16943523123928AA958221TENS1504T. cruzi epimastigote normalized cDNA Library
18303133404589AI075468TENU3060T. cruzi epimastigote normalized cDNA Library
18319193411453AI077145TENU3367T. cruzi epimastigote normalized cDNA Library


Date: 12:9:50 on Mon 20 Nov 117.