CcruzaQ_1082


Sequence

>CcruzaQ_1082 (2 EST) Length=397 GAGGTNANCAATTCGGCAGGACGGCAGCTTGCGCGCCCTTTCACGTGGTTTAATGGGCTCCAGGCANATAACGCAATATC CCGAAAGGCTCACTTCCGGGAAAGACCGCAGGAGATTGTTNGAGCGGTGCAATATAAGCACCTCATTCNTCATAAAGCAG AAATGCGTNNCCACTGCCAGCTTCATGAACGTCGTGGCCCCATCCGAGCAGTAATTAANTGCCGCTAANAAANAGGCGGC TGAACCCACGCATCGCACAAAAAGGCCTGTCTTTTCAATCGGGTCAAAACCACCCTGACGCCTCCCCAGTGCTGTCACCG AAGTACNGGAAATGTANTCCAATAAATNTGAGGGCCTGAAGAATTGAATCGACAGCGTCGCCGACCANAAAATNACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1082: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16889243115694AA952598TENS1782T. cruzi epimastigote normalized cDNA Library
16970693127238AA960740TENS1940T. cruzi epimastigote normalized cDNA Library


Date: 0:33:31 on Thu 23 Nov 117.