CcruzaQ_1083


Sequence

>CcruzaQ_1083 (2 EST) Length=408 TAAAAGACCTGAAGTGCATAAATCGCCACAAAAAACCAGCATCAAAAACCCCCCAGCTGAGTAGAGGCAAGAGGGATGCA TGTTTAATTATTGCCGGGGCGGTGGACGCGTCAAGAGTGAAGTGAGTTGCGTGTACCGTATCTTGCCGTCCTTGTCCGGC TGGGCCCCATCAAGCAACATGCGGGCTTTCTTCTCCCCCAGTACCCGAGTTTGCTGTGGCCTGCAGTTCAGCCAAATCCA CTTTGCCCGTTCCCGCCTTGTCAAACTCCACACACAACTGCGAGAGAACGGAAACAGCCTTGCCTTCATCGNAATACTGG TGGCGTTCGCTCCAATTNTAAAAAGGCAGGATTGTTTCGGAGCGACGGAACAAGGCGGTACATCGTNCAGGTACACAAGC ANCACCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1083: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703892267818AA525749TENF0003T.cruzi epimastigote normalized cDNA Library
17825983286520AI043263TENU0903T. cruzi epimastigote normalized cDNA Library


Date: 4:22:43 on Mon 20 Nov 117.