CcruzaQ_1088


Sequence

>CcruzaQ_1088 (2 EST) Length=430 TGTAATGGGGTAGAACGCCACCGGTGATTATGCGTGACATATTCCCGGCACCGCCTTTTGTGTGCATGCGTGCCATCGTC AGAGACACGGAACAACAGAGAGAAAATTGTATGCACCGCACGCCGCGGCAGAGGCACCAACAGANCCCCGCACCCTCCCA ATCCCCTCCTCCCCCTCTTCCTCCGCCGTTCAAGGTTTAAGAAGAATGAATGGGCAGAAAAAAAAATACCAAAAAAAAAG GGGGGAGGAGAATTACACGTAAAACTGTTCAATAAGCAAACAATCACACACACACACACAAAAAGGAAGAAAACGCAATG AAAAAGGAAAGGGTCAGTCACGCAAATTGTACCGGACAAGGATACCCCGTCACATATATGGNTGTATATTATAATTATTC ATTTATTTATAAATTACTGCTTCGTTGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1088: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020732981560AA875730TENU0201T.cruzi epimastigote normalized cDNA Library
17853923293898AI046265TENU1135T. cruzi epimastigote normalized cDNA Library


Date: 0:32:2 on Fri 24 Nov 117.