CcruzaQ_1094


Sequence

>CcruzaQ_1094 (2 EST) Length=520 CTGAACCCACAGAGTCAGAGTCAAAGCGGGAGTTGGATCGGTTGGCCGATGCACTTATTTCCATTCGTACCGGAATTGCA TCCATAGAGGAGGGTGAAGAGAGCACAACGAACAACGTTTCTCAAGAATGCCCCGCACACGGCAAAGTGTGTCACATCAG ATGATTGGGACAGACCATACACCCGGAAAACTGCTGCATTCCCTTCGAGCCATTCACACACCGAAAAGTTCTGGCCTTCA GTTGGCCGCATCGATGGAAACTATGGGGACAGAAACTTGATGTGCAGTTGTGCATTGAATAATTTTTGTGAGTAAAACTG TTGCAATGGGAGGCAGTAATTTTTTTAATTTATTTATTACCAATTTTATATTTTTATTTGTTTCTGCATCCGTTTCTTGG ATGATGGAGTGTTTTGGGCCTATTTGTGTCTGGTGTGATAAAACTGAACAGGGGGAGAGGGATATGATTGTGTGTGAGTG CGTGTTTGTCTGTGTGGTCGCAGAATGATTCTATGGTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1094: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828033290250AI043467TENU1026T. cruzi epimastigote normalized cDNA Library
17854763293982AI046084TENU1170T. cruzi epimastigote normalized cDNA Library


Date: 16:13:57 on Sat 18 Nov 117.