CcruzaQ_1107


Sequence

>CcruzaQ_1107 (2 EST) Length=469 TATGCGCGGTCCATTCACATTTGCTACTCTCGCCCCCAATAGAAACTTCCCTTTTCTGCTTTTTTCTACTCCAAAAGTTT TTTCTTCTTTTTTGTTTCTCATTGCTGTTTATAAGGAAAAATAAAAATAATAAATAATTCAACAGCCGCCTAGAAGCTCA TTCCAGAGAGCGTGCAGGCAAATAAACCACCACGCACGACGGACTTCATCGTCGGAGTCGTCTTTAGTCAACACCGTGAG GGACAGTGGCATATTAGCCCGATTATCATAAATAATTGCTGGTCAATTGTACTGCGTTTGCACGCTCGCCGCTGGATTCT TACTGTGCTGCCAAACATTCCTTCATAGCGCTACGTCAGTGTGTGCGACATGCTCACAGCAGAGTAAAGGAAGATCAGCT GTCCAGACGGCCATGAGAGGCACATTTCTCGCCGTATCCGTTTCAGTTTCAATCCCTCGTGCCGAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1107: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927092961979AA866534TENU0106T.cruzi epimastigote normalized cDNA Library
16944673124043AA958086TENS1619T. cruzi epimastigote normalized cDNA Library


Date: 4:41:33 on Sat 25 Nov 117.