CcruzaQ_112


Sequence

>CcruzaQ_112 (2 EST) Length=564 TGGAAAAAAGGGAACAGAAAGGGAAATGTTTTTTTTTGGGTATAATGGACTGTGATGCATTGATATCACTGATTGAACAA TGCTATGAGAGGATGTGCCGAAAAAAAAGAGCCTTGTGTTGGAATCTTTCAGGAGCTTTGTGTAACAGTCCGGCAGAAGT GATTTGTTTGATTAAAAACTTAGGACTGAGCACAAAATCACAAATAGAAGGGGGGCTGCGAGTTGCAACTGTTGCTCTTC TAGTTAATGGGACAATAAAGGGTTCTCACCTTGGTGATTCATCGGATATTTTGGGCTCTTTGTTAGCATGCAGGGTTTTT TTTTTAAACTGAGAAAATTTTCCGACGAAGAGAGGCATCATTTTCTTCTTCAGAGAAATATATTACATGCCTTGGCGGAG ATAAAGCAATGGATTAGAGGCTTTTTTAATTGCGAAAATCCCCTTCAGACGAAGATTCCTTTGGAAAAAAGGAGCATTTT GCAACTCATAGAGTTGATGCTAAAGAGAAATAGGTCATTCAGTGAAAGGATGTTGTTTGGATTTGGGCGCACTTTTGGTA AAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_112: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786921542832D87313D87313Trypanosoma cruzi Y (Tomoo Tanaka)
6786931542833D87314D87314Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 2:22:47 on Thu 23 Nov 117.