CcruzaQ_1123


Sequence

>CcruzaQ_1123 (24 EST) Length=1166 TCAGCGCCCACAACAAACAAACCCAACCCGATGAAAAAAAATATATTCGCCTGGGCTGCTGGCCGGATCCTGAAATCATC AAAAGAAATCAAACAAGAAGGGAAAAGGGGGGCAGTGGAGAGGCAGTGGGTTCGCCACTCCCTCGATGTTTGCTCCAAGT AAATATTGTTCCGATAGCCACTCTCGCGACACGGTGCACCTTGTTAGGATTGGAAACACTATCGCTTACCAAGTGGCAGA CCTTGGGCTCCGCCAGCCACAAGGCCTCGCCGCGAGGTGGGAATCAAAAAGGGGGTGGTGGGAAAGTAAGAAATAAAAAG TAAAGAAAAATCCGTCCTGTCGCTATCGGCTCCCTGGTTCCTTCAATCACCGTCCTCCAAAAATTCATAAGATAGAAAAG AATCGTGCAGAAACATCTCCGTTTCGTCAGGACATATTCATTTAGGTGACCAGCTCCCCCGCGAACATCCCTTTCACAAG TTAAAAATAAATAAATCAAAACAACATTAAATAAATTTTAAAATTAGGCGCACCGACGCTTCCCCCCACAAGTGGCGGGG CGGCGGTAGAAGATGTACATCAGCGCGCGGCCGTCGCAGAGAATGCACGGGCAGGCGGCACGGGGCCAGCACGCACAACC AAAGACACCGGAATATATACGTCCACACCGCTGCAGGGTGCTCAAATATACGCCGGCAGGCGCCAGTCGGTGCTCCCGCG CGTGCGGGCAGTGGCCGCACACAACGGGACTCCAGACCGACCGCACGCGCCCCGCCCCGTCCTCAGCACGCAGCACCGGC GGTCGCCACAGCGGCACTGACCAGCAGCAGCAGCGGCACCGGCACCCACACAGGGCCGCCAGGACTGCGCGCGTCTTCAG GAGTCGGTGCCTTGGAGGTAGTTGTGGTCGTGTTCTTGGGCGCACTGGAGGTAGTAGTAGACGTAGTGGTAGTGGTAGTC GTGTTCTTCTTCGGGTCGCCCCCAGCAGCCTCAAACACAGCAGCATCGTACTGCCCCTCCTCCTGGGCCGTGGCGCACAC GCACGCACAGCAGAGGGCAAAGACAAGCACGCAGAGGACGCGGCGCAGCATCATTGTCACTTGGGCCTTTGTGGACTTCG CTTGTTGCTCGCGGTGTAAACTCTCCAATATAGTACAGAAACTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1123: (24 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676791536866D87237D87237Trypanosoma cruzi Y (Tomoo Tanaka)
10776002130783AA433306TEUF0129T.cruzi epimastigote non-normalized cDNA Library
12064322327511AA556059TENF0258T.cruzi epimastigote normalized cDNA Library
13817082655786AA676122TENF0671T.cruzi epimastigote normalized cDNA Library
13817482655826AA676162TEUF0035T.cruzi epimastigote non-normalized cDNA Library
16061652988289AA879324TENU0224T.cruzi epimastigote normalized cDNA Library
16095552991704AA882593TENS0164T. cruzi epimastigote normalized cDNA Library
16095682991717AA882606TENS0177T. cruzi epimastigote normalized cDNA Library
16095722991721AA882610TENS0181T. cruzi epimastigote normalized cDNA Library
16095762991725AA882614TENS0185T. cruzi epimastigote normalized cDNA Library
16096132991762AA882651TENS0224T. cruzi epimastigote normalized cDNA Library
16581363073655AA926519TENS1141T. cruzi epimastigote normalized cDNA Library
16889273115697AA952601TENS1785T. cruzi epimastigote normalized cDNA Library
16890573115827AA952731TENS1915T. cruzi epimastigote normalized cDNA Library
17826763286598AI043341TENU0982T. cruzi epimastigote normalized cDNA Library
17926653321001AI053374TENU1539T. cruzi epimastigote normalized cDNA Library
17972683331683AI057817TENU1908T. cruzi epimastigote normalized cDNA Library
17973263331741AI057875TENU1966T. cruzi epimastigote normalized cDNA Library
18057363366393AI066228TENU2343T. cruzi epimastigote normalized cDNA Library
18244213392659AI069684TENU2728T. cruzi epimastigote normalized cDNA Library
18245403392778AI069803TENU2875T. cruzi epimastigote normalized cDNA Library
18386883417100AI080848TENU3705T. cruzi epimastigote normalized cDNA Library
18688003482807AI110387TENU3943T. cruzi epimastigote normalized cDNA Library
18689223492559AI110505TENU4056T. cruzi epimastigote normalized cDNA Library


Date: 6:12:44 on Wed 22 Nov 117.