CcruzaQ_1136


Sequence

>CcruzaQ_1136 (3 EST) Length=417 GGCACGAGGATATTGTGTGGGGGATATCGGGTGGTGCGGTGAGCCAAACTGCCACCTCTCATTGTGGTGTCCCGTTTCTG GGAATATGTAGCACAACATTACTTGGGCGCATGGTCAACGGTAAGAGACATGCCGTCGTGGCGAGGACGGCGGTTCACTT CATGACGAAGGACAGTAAACGGCTCAAATGATAACGAGGCCAGCTCATAAAAATGACGCTTCCAAATTTAATAAATCGAC GGTTTTGTGGCGCACCGTGTGACGTTACTGCAAAACGCGTTTCAGCGAAATGATTTTCTTCTGCATAGACGTGTTGGCGA GTCGNCGTTGCCGGGATGAGCCCGATGATCTAGCGGAGTTGAATTGCCTCCGCATGGGCTACAAATGAAGNCCTTTAATC TTTCACACCATCCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1136: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703862267815AA525746TENF0094T.cruzi epimastigote normalized cDNA Library
17973253331740AI057874TENU1965T. cruzi epimastigote normalized cDNA Library
18688143482821AI110401TENU3957T. cruzi epimastigote normalized cDNA Library


Date: 13:57:37 on Mon 20 Nov 117.