CcruzaQ_1151


Sequence

>CcruzaQ_1151 (2 EST) Length=421 AGTGGATCGATCGGCGCAGTAAACGTATTCCTCACAACNNGAAGGACGTCTGGCTTTTTGGCGAGCAGCCGAGCTGTGCG CTCTGTCACGTGCGGTTCCGCTACAAGCAGGACTACGAGGCACACAAGGAGAGTGAACTGCATCGAAATCGTGTGCGATG GGTGGAGACAATGAATTGGTGGAAGGAATTCGGCGAGCCGCGGTACCTGCAGCACGCCGCGGCCGAATGGGACTGGTTTG AACAACACGTGCTCCCAAAGAAGGCGGCTGCCATGGGGAATTTCTCTCGAGGAGGCGGCACGACACTTTCGCCGTGCGAC GATTGCAGGAAACCCCGGATTGGCACGGGCCGTTTGCAGCCGCCCAGCGCACGATCGGAGATCAAAGAGGCCACGGGATC AGCGTTGGCCGTCGTCACCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1151: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816142655692AA676028TENF0545T.cruzi epimastigote normalized cDNA Library
18302503404526AI075575TENU3152T. cruzi epimastigote normalized cDNA Library


Date: 15:0:50 on Wed 22 Nov 117.