CcruzaQ_1195


Sequence

>CcruzaQ_1195 (3 EST) Length=723 GCGGCGCTGACATGAAGCACTTTGACCCACGAAGATCCAATCCATTCCTGATGCCGTTGAATATATTTCTCAAAATCCAA TGGCCAAATAGATCGTTTAATAGCATCATGTAGTGGAGGGTGTGTGGTAGCCTCGGGTCCCTTTTTAACCGCTGAAATTG TTATGAGAGTTTGTTTATTCGATTGTTTTACCTTTATTTTTAGGATTAGCTTTTAAATAACTCTAAAAGGGTTATCCTTC TCTCTTTTAACAAATTTTTATTTATTTATTTTTTTAATGCACTTCTTTCAGTATGGGAAGAAATGAGGGAGGAGAGGGAA CTGAAGGAAGGGATCGACCGCTCATCAAAACTGTAGTCATGGATAAAATTAGACATCAATGAATTTACTGATGCCTTTGT GGCGTTATTATTATTATTATTATTATTATTCATAAGCACACCAATCACAATATATTTAATCTTAATTATGCGAAGCGCGC TGCTAAAACACAGTGTTTAGGTGAGGACGCGTACGCGCCAAGAATTAGGTAGGCAAGGTTGAGGAGGGAAGGGGAACCGA GGTAGAGGCAAACGGAGAAGGAAAGAGGAAGAAGGGAAGGAAAGGAAAGAAAAGAAAAGAAAAGCTAGCATTATTTATAT TTATTAATTTTGGATGTGATCTTGTTTTGGAAAGACTTGTTGTGGTATTATTATTAATTCAGTAACTATAAAATAAACTA AAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1195: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6675991531545D87560D87560Trypanosoma cruzi Y (Tomoo Tanaka)
16063232988501AA879391TENU0257T.cruzi epimastigote normalized cDNA Library
17656193244237AI026411TENU0622T. cruzi epimastigote normalized cDNA Library


Date: 17:43:20 on Tue 21 Nov 117.