CcruzaQ_1205


Sequence

>CcruzaQ_1205 (2 EST) Length=734 AGAGGTGTGGCTGCACAAGAGTGATTTCTGCGAAAAGGTGGTGCAGTACTTTGTCGACCTATTCAAGACTTACCCCGGCA TCAGAGTCGCTCGTCGTCCCATCAGCAGTGAAGTTACTGCCGATTGATTCTCGCACCGATTTTATTTTTGTTTTTCTTGA CTCCGTGTATGCGTGTGCGTTTGCGCATGTACATATATATGGCGAGCTAATTTAGTGGGAGACAGGCGGCAATAGAAGCG ATACAACGAAGAGGGGAAATTGTCTAGGAGCATATATACAAAAAGCATGATATTTAGCTTTAAAAAAAAAAAAAAAGGCG AAACGGAAGAGTTATTAAGGCGACACGACGGTCAGGAATTGTGGTGGGTTGTAGAAAAAACAGGAGGACGTCAATTCTAG TTGCCGATGTGGCAAAGATGCGTGTCTATTATTTAAATTTATTTATTATTATTATTATTATTATTATTTTTTTTGTGTGT GTAACTTTGCCCTAGCACATGAGAGAGACCTCTGGAGCAGGTGAATTTGGCAACCAGGAAGAGGGGAGAGCCAAAGAGAA GGAAGGAAATAACCTAAAAATAGAGGGTTGCGTGGGGTTTTGCTGGAATACACCGCAAAGTCATTTGCCACCGCCCTATT TGAAGCTGTTTCTAGTATTTCTGTACGTGACCACACCACCACAATGGATGTGTCCTTCCCTCGGATTGCGGAGCGCATGA CTGTCAATAAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1205: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17970953331510AI057644TENU1734T. cruzi epimastigote normalized cDNA Library
18046573340609AI065202TENU2083T. cruzi epimastigote normalized cDNA Library


Date: 0:23:5 on Sat 25 Nov 117.