CcruzaQ_1209


Sequence

>CcruzaQ_1209 (2 EST) Length=474 GCAATAATTACACAAATACAATCAACACAACACATTTCATAAATGAAGGGGTATGCGTTCACTTTCCCATTGGCCCACTG CAAGCACGTACCACGCACAAACAAATGGCCTTCCTCCTTCCCCCTACTTTATGTAACCTCCTTTATTTTTCCTCTCTTTC TTTCTCTCTCTCCCGCTCTCTCTCTCTCTCTGTGTGTGTGTGCCCTTTTTCTTCCTCATCTTCGCTGGAAGCTCGCCCCA CTCTTTCCTTCCCACCACCCGCACCTTCGTGGAGAAATGGCAGCGAGATACCGCGCAGAAACACACACAAAACACCATCA CGCAGTTACAGAAAAAAGATAGATAGATAGAGAAGAAAAAAAAAAAAAAAAGAGAGAGAGAGAGAGAGAGAGGAGAAATC CTTTTCTATCTTTTGATTTTTCCTCCCTCTTCATTCCGTTGACGACATTTCTGATGCTTGCTCTCTCCCCTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1209: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927923321128AI053249TENU1674T. cruzi epimastigote normalized cDNA Library
18336833415197AI078925TENU3643T. cruzi epimastigote normalized cDNA Library


Date: 2:25:35 on Thu 23 Nov 117.