CcruzaQ_121


Sequence

>CcruzaQ_121 (2 EST) Length=673 GTGTATCCCCAGAATGAATGAAAGGAAGGACGAAAGGAACGAAAGGCCACTGTCACCGTCAGAGCATTCACCCACTCACA CATCTCATGACTTCTAGGAAAGGGGTAACTGTAGGAGTTAAATGTGCATGTCCATATGTATTTTGCAATGTCTTTTCTTT TCTTTTCTTTTCTTTTTTTTCCTTTCTTTTTGGTGTTTACTGTACTCACCGCATGCAACAGTGGTCTGAAAGCATTCATC AAACAGCAGCAGCTATTTTAGTGTGATATCATCATTCATCCTTACCCAACTCTCTTTCCTTCTGCCCCACAAGGGATGAA TCCACGTGAAGGTCAAACTGAAGGCCAATCACTTCCGAGAGCTTCTCCACCTGTCGAGCACTAAGTAACGCAAGAGAACG CATGGACGGCAGCAATGCAAGTTGATCCTCGTGATGCTGCACCAACTCCAGTGTTCCAAGAGCTCCTTTTTGAACGTGCC TGCAGCGGCATCATGCGCGCTGGCAGAGTTGCCCCAGTAGAAAAAGCAGTACGCTGTCCAATCCGGTCAGTTCATTAGCA GAAACATCGGAGTCTTGGAGGAGCGACGTCGATGCTGCCTCCTGCACAAAAAGTGTCACGCAATGCTCTATGCTCTCACG AAGCGTGTCGAATGCATCGGCGGTGGAGCACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_121: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855023294008AI046110TENU1196T. cruzi epimastigote normalized cDNA Library
18243593392597AI069622TENU2623T. cruzi epimastigote normalized cDNA Library


Date: 14:29:9 on Sun 19 Nov 117.