CcruzaQ_1213


Sequence

>CcruzaQ_1213 (3 EST) Length=586 GAAGCCACGTTGTCGCCGGGCGTGGCCTCGGCAAGCTGCTCGTGGTGCATCTCAATCGACTTCACCTCCGTCGTTAACGT TGGCGGCGCAAACGTCACCACGTCGCCGGCTTCATCGTGCCCGTTTCCACGCGACCGACCGGCACGGTGCCGATGCCGCC GATCTTGTACACATCCTGCAACGGCAAGCGCAGCGGGCTTGTCGCTGGGGGCGCACCGGGGGCTCCAGCATGTCGAGTGC CTCCAGCAGCGTGGGGCCCTTGTACCACGGCATATTTTCCGACTTGTCAATCATGTTGTCGCCCTGCCAGCCGGAGATGG GGATGAAGCGCACCTTCTCCACGTTGTACCCAACCTTCTTCAGGTACGCCGACACCTCCTTCACAATCTCATCGTAGCGC TCCTGGGCGAAGTGCACCGACTTGTCGTCCATCTTGTTGCAGCACACAACCATCTGCTTACGCCGAGCGTGAAGGCGAGC AGCGCGTGCTCGCGTGTCTGGCCGTCCTTCGAGATGCCCGCCTCAAACTCACCCTGCGATGACGCAATGACAAGGACGGC GCGTCCGCCTGAGACGTGCCCGTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1213: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709732107917AA426680TEUF0259T.cruzi epimastigote non-normalized cDNA Library
12064262327505AA556053TENF0232T.cruzi epimastigote normalized cDNA Library
18244873392725AI069750TENU2795T. cruzi epimastigote normalized cDNA Library


Date: 9:49:56 on Thu 23 Nov 117.