CcruzaQ_1223


Sequence

>CcruzaQ_1223 (2 EST) Length=547 ATTCTGGATGTGCGCTGCGTGCGAGAAGAATAATCGTGTTGATGACCTGGACGACAACAGCCGCTGCGGATTTTGCGGGT ACGATATGGCTCCCATGACAATGACTGAAGCAGAGGCACTTCGAATTCAACAGGAGCGGTCCCAGCGGCTCCGTGAGAAC AGGAGTAATTTGACAGCATTTCGGCCAGGGAAGCGGATGAACAGTTTGGTGATGAGGCCGCTGGTGCCTCGGCTCTGCCC ATGAGCCTGAAACAAGCGCCATCAGCCGCCTTGCGAAACTTTCCCAGCGTTCCTGAGGTGAAACCATTTGCTCCTTCTCC CATAGAAACAGCCCACTCACGCATTTCCAGGAAACCGAAGCGATCATTGCCAACAGGAATTCCGCCAGACCACCCGGTTT TGATTGGATGTGCCGTGAGCAAGTTGTGGCACGATTAACGCCGGTGACGAAGAGAGTTGTACCAGTTGCGGTAAACACAT CGCACCCGCCGAGTGGGAATGCTGGCACTGCGGAGCAATTGATCACTTGAGTCGATCAAGATGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1223: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775912130774AA433297TEUF0114T.cruzi epimastigote non-normalized cDNA Library
18047523340704AI065297TENU2184T. cruzi epimastigote normalized cDNA Library


Date: 2:17:40 on Thu 23 Nov 117.